ANNALS OF
HUMAN BlOLOGY, 2004. I -8,
preview article
Molecular,
forensic and haplotypic inconsistencies regarding the identity of the
Ekaterinburg remains
Knight*,
P.Scott White
** **
and
*Department
of Anthropological Sciences,
**Vavilov Institute of General genetics, Russian Academy of
Sciences, Moscow, Russia;
***Deparment of Biology, Eastern Michigan University, Ypsilany, Mi 48197, USA;
**** PO Box
19754, Stanford, Ca 94309, USA;
** **
Bioscience Division, B-1 Genomics, Mailstop
M888, Los Alamos National Laboratory,
Los Alamos, NM 87545, USA;
** ** **
Department of Genetics,
(Received 10 September 2003; accepted 4 November 2003
)
Summarv. Background: A set of human remains
unearthed near Ekaterinburg, Russia has been
attributed to the Romanov Imperial Family of Russia
and then physician and servants.
That
conclusion was officially accepted by the Russian government following
publication of DNA tests that were widely publicized. The published study
included no discussion of major forensic discrepancies and the information
regarding the burial site and remains included
irregularities. Furthermore, its conclusion of Romanov
identity was based on molecular behavior
that indicates contamination rather
than endogenous DNA.
The published claim to have
amplified by PCR, a 1223 bp region of
degraded DNA in a single segment
for nine individuals and then to have obtained sequence of PCR products derived from that
segment
without cloning indicates that the Ekaterinburg samples were contaminated with non-degraded,
high molecular weight, 'fresh' DNA
Aim: Noting major violations of standard forensic
practices, factual inconsistencies, and molecular behaviors that invalidate the
claimed identity, we attempted to replicate the findings of the original DNA
study.
Subject. We analyzed mtDNA
extracted from a sample of the relic of
Grand Duchess Elisabeth, sister of
Empress Alexandra.
Results: Among clones of multiple PCR targets and products, we observed no complete mtDNA haplotype matching that
reported for Alexandra. The consensus haplotype
of Elisabeth differs from that reported for Alexandra at four sites.
Conclusion:
Considering molecular
and forensic inconsistencies, the
identity of the Ekaterinburg
remains has not been established. Our mtDNA haplotype results for Elisabeth provide yet another line of conflicting evidence regarding the
identity of the Ekaterinburg
remains.
I. Introduction
In 19I8 The
family of Nicholas II, last Imperor of Russia,
disappeared, presumably murdered by the Urals Reds. Shortly thereafter the
White government appointed investigator. Judge N. Sokolov.
concluded that The Family had been shot in Ekaterinburg,
Russia, and that their bodies had been chopped into pieces, burned to shards of
bone, and destroyed by soaking in sulphuric acid (Sokolov 1425. O'Conor 1971).
There are
many remains buried in shallow, unmarked mass graves near nkalcrinburg,
victims of the Russian Civil War (Summers and Mangold
I976). One such grave, assumed to contain remains of The Family, was claimed to
be discovered and opened in 1991 (Gill et
ul. 1994). The case has been characterized by
extreme irregularities at every level (e.g. Massie I995, Zhivotovsky
1999, McNeal 2001). Activities at the burial site and with the remains are no
exception. Crucial evidence has been proven fraudulent. There is evidence that
the "Yurovsky Note', detailing the location of
the grave and thereby providing the means for the 'discovery', was forged (Buranov 1994). The grave was of unknown age and had been
opened several times prior to its official 'discovery (Zhivotovsky
1999). The two 'discoverers' of the grave were described in Gill at ul. (1994)
as amateur historians" when in fact at least one was an agent of the
Internal Minister of the USSR. They had opened the site in 1979 and removed
several skulls and other bones and then added skulls and bones about a year
later (Zhivolovsky 1999). There are also indications
that the grave had been opened by the Stale Security services in I946 (Koltypin-Wallovskoy et
al. 1998). The purported site of the murder, the Ipatiev
house in Ekaterinburg. was levelled
and entirely destroyed in 1977 on the insistence of KGB Chairman Yuri Andropov
and under the direction of Boris Yeltsin, at that time the first Secretary of
the Sveldlovsk (Ekaterinburg)
district branch of the USSR Communist Pariy (Massie
1995. McNeal 2001).
The Russian
government has officially declared the case of identity of the remains
purported to be those of the Romanov Imperial Family
of Russia to be settled. Essential to that declaration was the report
describing DNA results (Gill et al. (1994).
At a conference in 1992 Russian geneticist P. Ivanov
announced that he would conduct DNA analysis of the remains (Ivanov 1994). In 1994. the results of those DNA analyses
were published, suggesting identity of Nicholas and Alexandra, three of their
children, the family physician, and servants (Gill et al. (1994). That report did not mention numerous irregularities
of the case. The summary of the events described in (Gill et al. (1994) states that the grave was discovered in 1991 and
tacitly introduces the assumption that its contents were intact. As detailed
above, the remains were not intact at all. The chain of custody of the samples
utilized in (Gill et al. (1994) was
not provided in the published report and has not been provided since.
Furthermore, the authors have refused to provide their original 'raw' data to
other scientists (McNeal 2001), and improper procedures by any individual who
had control or access to the samples could have led to contamination and
misidentification. The handling of the samples throughout the entire
investigation has been characterized as 'rude violations of archaeological and
forensic norms' (Krukov 1994). The statistical
analyses of the DNA results were flawed (Zhivotovsky
1999). Individual bones rather than skeletons were the units of analysis (Zhivotovsky 1999). identity of individuals was disputed and
the skeletal assignment of some bones was controversial (Massie I995). The
remains were in fragmented, deteriorated condition (Gill et al. (1994). Massie I995). The skull attributed to the Emperor
had no indication of the known scar from a sword wound acquired diring an assassination attempt (McNeal 2001). The Russian
co-author of the DNA report. P. Ivanov. had custody
of all the bone samples from the remains, participated in the analyses,
interpreted and summarized the findings on behalf of the Russian governmental
Commission for Study of Problems Related to Investigation and Reburial of the
Remains of The Russian Emperor Nicholas II and the Members of the Family, and
then voted on acceptance of the final communique
(Russian Governmental Commission I998, Zhivotovsky
1999) Note that the lengthy full name of the Russian Governmental Commission
reveals an a priory bias toward the
Commission's final conclusion.
During the
last decade, the field of analysis of degraded DNA samples has progressed and
much new technical knowledge has been gamed. As the field has matured, rigorous
standards for peer review and publication have been established (Cooper and Poinar 2000. Hofreiter el al. 2001). Those standards were not
in place at the time that the report on the DNA identity of the Ekaterinburg remains was reviewed for publication. If
present knowledge had been available for referees at that time, the DNA
evidence would have been judged in a qualitatively different context.
DNA
extracted from deteriorated bones having been exposed in a shallow, damp.
earthen mass grave for 70 years is chemically degraded (if detectable at all)
and should behave as degraded DNA (e.g. Cooper and Poinar
2000, Hofreiter el
al. 2001, Jehaes et al. 2001a. Stone et al. 2001).
Fragments are sheared to smaller than 250 bp or are
completely destroyed (e.g. Bailey el al. 1996,
Jehaes et al. 2001
b, Stone et al. 2001). Polymerase
chain reaction (PCR) amplification of targets as large as 1223bp, reported in
Gill et al. (1994) for nine different
individuals, is now regarded as certain evidence of contamination and
invalidates results (Cooper and Poinar 2000, Hofreiter el al.
2001). PCR products of degraded DNA larger than 250 bp
yield erroneous molecular results, whereas shorter products generally yield
authentic results (Jehaes el al. 2001 a). Yet. Gill et al. (1994) report that 'the quality of
the sequence was generally comparable to that produced from the fresh blood
samples". DNA degrades rapidly after the death of an organism. Long before
70 years have passed, degradation reaches the 'ancient' condition (Jehaes et al. 200la)
Mitochondrial sequences must be amplified in short fragments (e.g. Cooper and Poinar 2000, Hofreiter el al. 2001, Jehaes
el al. 200lb). Examples of similar
historical cases, such as the identification of Louis XVII (Jehaes
el al. 2001 b) and Jesse James (Stone
el al. 2001) serve to illustrate
expected molecular behaviors. Molecular behaviors reported in Gill et al.
(1994) were wholly inconsistent with the behaviors of degraded DNA
and such behaviors have not been reported elsewhere for similar cases. That
observation indicates that the samples assumed to be of the Romanovs
were contaminated with non-degraded, high molecular weight, 'fresh' DNA.
A central
tenet of science holds that results reported by a single research group do not
establish conclusions with certainly. Noting the plethora of major problems
associated with the entire Romanov investigation, we
attempted to replicate the findings of the DNA study. In doing so, we uncovered
evidence that casts set additional doubt on the findings reported in Gill et al. (1994). In cooperation with the
Russian Expert Commission Abroad, we have conducted mtDNA
analysis of the relic of Grand Duchess Elisabeth Feodorovna,
sister of Empress Alexandra. Bishop Anthony Grabbe of
the Russian Orthodox Church Abroad, who oversaw the opening of Elisabeth's
coffin in Jerusalem in 1981 and has kept the relic since that time, allowed collection
of the sample. Controlled experiments of the molecular behavior of the relic
DNA were consistent with all other such old samples analyzed in the literature,
in that PCR amplification was not attainable for fragments larger than 250 bp. Two independent tests were performed, one at Stanford
University and the other at Los Alamos National Laboratory.
2. Materials and methods
2.1.
Chain of custody
The chain of custody of the remains of Grand Duchess Elisabeth is as follows (Sokolov 1925, Millar 1991). There is historical information from local people that Elisabeth remained alive for some time in a mineshaft near Alapaevsk after grenades were tossed by the Red executioners. Locals for fear of the Reds did not rescue her. Her body was identified by Elisabeth's Father Confessor. Monk Seraphim, and by the White government commission headed by N. Sokolov. Sokolov described the body: On the chest of Grand Duchess Elisabeth Feodorovna there was an icon of our Savior adorned with precious stones. According to my information, this was the same icon The Imperor prayed to before his abdication from the throne. He gave it to Elisabeth Feodorovna.
The body
was washed, dressed, and placed in a wooden coffin. A memorial service was held
on 18 October 1918, attended by 13
priests and many other people. On the morning of 19 October, the coffin was
placed in a crypt beneath the Holy Trinity Cathedral. When the Red Army once
more advanced on Alapaevsk. the coffin was shipped to
eastern Siberia, then Shanghai, and from there to Jerusalem. On 15 January
1920, the coffin was met by English authorities, Greec
and Russian clergy, and crowds of the Russian colony and locals. The following
day the coffin was placed in a locked crypt beneath the St Mary Magdalene
Russian Church where it remained for the next 62 years. From the time of the
identification and sealing of the coffin, to Siberia, to Shanghai, and to
interment in Jerusalem, Elisabeth's Father Confessor, Monk Seraphim,
accompanied the coffin. On I May 1982, the coffin was opened. The ceremony was
attended by Orthodox and non-Orthodox lay people, and clergy from many places
including the USA. Australia, New Zealand and Europe. There was an inscription
on the coffin of Elisabeth. It read, The body of the Grand Duchess Elisabeth Feodorovna, murdered by the bandits of the Soviet regime.
Buried on 19 October 1918'. The relic was taken to New York by Bishop Anthony Grabbe, and there the sample was retrieved by one of us
(A.K.) in the presence of the Bishop, who had attended the opening of the
coffin and brought the relic from Jerusalem to New York. The relic has been
kept in a small case in his reliquary.
2.2.
Sample preparation
The relic
of Grand Duchess Elisabeth provided by Bishop Grabbe
is a finger resting in a small closed wooden case with a glass lid. The linger
consists of bone and hardened, dried flesh. The case was opened to access the
relic. With latex-gloved hands, a new, sterile scalpel was removed from its
sealed package. Four small pieces of dried flesh and bone were cut and removed
and placed with the scalpel blade into DNA-free microcentrifuge
tubes, which were immediately sealed. Two of these tubes were opened and
processed at Stanford University, and two others were opened and processed at
Los Alamos National Laboratory.
2.3. DNA
extraction
Each
portion of the relic was digested in the original tube al 37 C for 72 h in a
50o mL solution of STE (100 mM NaCl2 10 mM Tris, 1 mM EDTA, pH 7.5) containing
20 mL I M dithiothreitol
in 10 mM sodium, pH 5.2: and 25 mL of 20% SDS. Fifty mL of 20 mg mL-1 proteinase
K in STE was added several times during the 3-day digestion, and the solution
was mixed each time. The sample was partly, hut not completely, digested by
this process. Following digestion, DNA was isolated by two extractions in PCI
(25:24:1 mixture of phenol, chloroform, and isoamyl
alcohol. pH 8.0). Phenol was removed by two exlractions
with chloroform. The supernatant was collected. DNA was precipitated in ethanol
and sodium acetate, pelleted at 10000 x g for 10 min, dried, and resuspended
in 0.1 x TE (I mM
Tris, 0.1 mM EDTA, pH 8.0).
2.4.
PCR amplification
PCR
experiments were conducted to test the molecular behavior of the relic DNA.
Five different
PCR
reactions were performed, each with a positive control consisting of high
molecular weight DNA from a human cell line, the relic DNA. and a negative conlrol to test for contamination. The cell line was froni an individual of East Africa of mitochondrial haplogroup L2, with an HV1 sequence different from that
found for the relic of Grand Duchess Elisabeth. In all cases, primers targeted
mitochondrial regions. Target sixes were: 1179 bp,
466 bp, 437 bp, 128 bp and 108 bp. In all cases very
strong amplification was observed for cell line DNA. All negative controls were
blank. For the relic, no amplification occurred for 1179, 466 or 437 bp targets. Weak amplification occurred for the 128 bp target. Moderate amplification occurred for the 108 bp target. PCR primers for the I08bp target were LI6060
(AGATTTGGGTACCACCXAAG) and HI6I68 (CGGGTTTTGATGTGGATTGG). To test the region
spanning the position 16357, a 111 bp target was
amplified. PCR primers for the 111 bp target were LI
6273 (AGCCACCCCTCACCCACTAG) and H16384
(GTGGTCAAGGGACCCCTATCTG).
Those primers produced strong amplification of the relic DNA.
Several PCR
amplifications of the relic DNA were conducted separately from positive
controls. Reactions were prepared on ice, and placed directly into an Applied Biosystems 9700 or MJ Research PTC-200 thermal cycler preheated to 94o C. Touchdown PCR was
employed. Denaturing was al 94o C for 15s. Annealing was initially
at 65o C, dropping 0.5o C each cycle for 20 cycles to 55o
C, followed by 20 cycles at 55o C. Annealing time was 30s. Extension
was at 72o C for 30s. following amplification, a single 2-min
extension step al 72o C was employed.
2.5. Cloning of PCR products
Direct
cloning of PCR products was performed by TA cloning into the pCEMT-Easy vector (Promega, Madison, WI, USA), followed by
transformation in competent E. Coli TOP
10F` cells (Invitrogen Life Technologies, Carlsbad,
CA, USA) Plasmid DNA was isolated using either the Concerl
Rapid Plasmid Miniprep Syslem
(Invitrogen Life Technologies) or the Wizard Plus SV Minipreps DNA Purification System (Promega)
and analysed by EcoRI
digests, agarose gel electro-phoresis,
and sequenced
2.6. Sequencing
PCR
products were prepared for sequencing using QIAGEN (Valencia. CA, USA) OIAquick PCR Purification columns. PCR products and
plasmids were sequenced using Applied Biosystems (Fosler City, CA, USA) BigDye
Terminator Cycle Sequencing Ready Reaction DNA Sequencing Kit, following the
manufacturer's instructions. Ready Reaction premix was diluted four-fold using
Applied Biosystems 5X sequencing buffer. PCR primers
were used for direct sequencing. T7 (TAATACGACTCACTATAGGG) and SP6 (
ATTTAGGTGACACTATAG) primers were used to sequence clones. Sequences were
separated and visualized on Applied Biosystems
genetic analysers.
The sample
was collected by A.K. DNA extractions, PCRs, and
sequencing were carried out separately by A.K. (at Stanford) and L.D.G. (at Los
Alamos). TA cloning o PCR products was carried out by D.H.K. at Eastern Michigan University. Sequences of mtDNA of A.K. and L.D.G. differ from the sequence found for
Elisabeth and for the purported Alexandra.
3. Results
3.1.
Direct sequencing
Direct
sequencing of PCR products of Elisabeth's mtDNA
revealed a haploltype different than that reported in
Gill et al. (1994) for the remains of the purported
Alexandra. The sequence of purported Alexandra had two differences in hypervariable region I in comparison to the reference
sequence (Anderson el al. 1981 ),
16111T and I6357C. It is notable that this haplotype
has not been reported elsewhere. Between PCR primers L16060 and H 16168, direct
sequencing revealed a haplolype for Elisabeth that differs from that of purported Alexandra
at two sites, having 16111C and 16129A. Between PCR primers L16273 and HI6384.
direct sequencing revealed a haplotype for Elisabeth
that differs from that of purported Alexandra at two additional sites, having
16327T and 16357T. Sisters are expected to have identical mtDNA
haplotypes.
3.2.
Cloning
We
performed two additional PCR amplifications of each region, of which direct
sequencing produced results identical to the first tests. We then cloned these
four PCR products and sequenced the clones, remaining consistent with the newly
established guidelines (Cooper and Poinar 2000, Hofreiter el al
2001) for degraded DNA. Of 19 clones of products of L16060-H16168 (table I),
two clones matched the partial haplotype of purported
Alexandra, having 16111T and 16129G. The haplolype
16111T with
16357C, reported in Gill et al. (1994)
for Alexandra, is otherwise unknown and was not observed in over 17000 mostly
European mtDNAs (unpublished database of Estonian Biocentre, Tartu) or in the
extensive European data set of Richards et
al. (2000). Seventeen clones matched the direct sequence result for
Elisabeth. For the products of L16273-H 16384, of 21 clones, none matched
purported Alexandra, 16 matched the direct sequence result for Elisabeth, and
five mismatched both (table 2). We call attention to the fact that such a level
of multiple
Table I Nuclcolides at positions 16273 and 16129 in clones of PCR products E1 and E2, produced by PCR amplifcation with primers L16060 and H16168. No asterisk
indicates match to direct sequance of Elisabeth PCR
product.
|
PCR product |
No. of
clones |
Haplolype |
|
E1 |
9 |
16111C, 16129A |
|
|
1 |
16111T, 16129G* |
|
E2 |
8 |
16111C, 16129A |
|
|
1 |
16111T, 16129G* |
* Match to purported Alexandra
Table 2. Nucleotids at
positions 16327 and 16357 in clones of PCR products E3 and E4. produced by PCR
amplification with primers L16327 and 16357. No asterisk indicates matches to
direct sequence of Elisabeth PCR product.
|
PCR
product |
No. of
clones |
Haplolype |
|
E3 |
8 |
16327T,
16357T |
|
|
2 |
16327C,
16357T* |
|
E4 |
8 |
16327T,
16357T |
|
|
3 |
16327C,
16357T* |
*Mismatch
to both purported Alexandra and Elisabeth.
sequences
is typical in clones of ancient DNA (aDNA) PCR
products from truly ancient samples and more recent forensic samples (e.g. Krings et al. 1997.
Jehaes et al. 2001b).
4. Discussion
Standing
alone, the molecular behaviors reported in Gill et al. (1994) negate the
conclusion of that report. Thai single
factor is the basis for our conclusion that the samples analysed
in the study of Gill et al.
(1994) were contaminated. Our doubts of the identity are further
supported by the context of gross violations of forensic investigative norms
and factual inconsistencies. In light of those considerations, possible
explanations for our results include the following.
(1) The actual sequence of Elisabeth does not match the sequence reported in Gill
et al.
(1994). In that case it is probable that the Ekaterinburg remains were misidentified, as the identity
and chain of custody of the remains of Elisabeth are well known and documented (Sokolov 1925, Millar 1991).
(2) The actual sequence of Elisabeth does match the sequence reported in Gill et al.
(1994). In that case, the endogenous actual sequence of the relic of
Elisabeth is in extremely low copy
number and old, degraded contamination is in relatively higher copy number.
Therefore, the endogenous sequence was not observed among 21 clones of the
L16327 - 16384 region and only two of 19 clones of the L16060 and H 1616I29
region. In that case, as indicated by the molecular behaviors reported m Gill et al.
(1994), the samples from the Ekaterinburg remains were contaminated in the study of
Gill et al. (1994) with non-degraded,
high molecular weight DNA from a source of the same mtDNA
lineage as carried by Elisabeth.
Regardless
of the explanation for our results, the molecular behaviors in Gill et al.
(1994) leave the DNA identity of the Ekaterinburg remains
as an open question. Standard practice is to establish endogenous sequence of
degraded DNA by consensus of clones. The mismatch of the consensus sequence of
Elisabeth, and the lack of the clones of the two regions analysed
in combination to produce the haplotype attributed to
Empress .Alexandra, is simply yet another discrepancy in this unresolved case.